Stem-loop sequence ami-mir-92b

AccessionMI0029704 (change log)
DescriptionAlligator mississippiensis miR-92b stem-loop
Stem-loop
   uccggggcggcgggagggccgggaugc            ugcgu 
5'                            ggugcaguguug     c
                              ||||||||||||      
3'                            ucacguuauaac     u
   ---------------------------            caucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ami-miR-92b-3p

Accession MIMAT0038103
Sequence

15 - 

agggccgggaugcggugcaguguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).