Stem-loop sequence ami-mir-33-2

AccessionMI0029699 (change log)
DescriptionAlligator mississippiensis miR-33-2 stem-loop
Stem-loop
   -  ----  ug     ag   u  -          uu        ug g    
5'  gc    ag  gccuc  cug gg ugcauuguag  gcauugca  u uca 
    ||    ||  |||||  ||| || ||||||||||  ||||||||  | || c
3'  cg    uc  cggag  gac cc acgugacguc  cguaacgu  g aga 
   a  accc  cu     ga   -  g          uc        gu g    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001118.1: 1812-1909 [-]
intergenic
Database links

Mature sequence ami-miR-33-5p

Accession MIMAT0038092
Sequence

19 - 

gugcauuguaguugcauugca

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-33-2-3p

Accession MIMAT0038094
Sequence

57 - 

caaugccucugcagugcagc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).