Stem-loop sequence ami-mir-30c-2

AccessionMI0029693 (change log)
DescriptionAlligator mississippiensis miR-30c-2 stem-loop
Stem-loop
   --gc       ga    uauu       u   aca         guggaa 
5'     ucugagu  cagg    guaaaca ccu   cucucagcu      a
       |||||||  ||||    ||||||| |||   |||||||||       
3'     agauuca  gucc    cauuugu gga   gagggucga      a
   cgau       --    cucu       c   --a         aggagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000483.1: 1500928-1501023 [+]
intergenic
Database links

Mature sequence ami-miR-30c-5p

Accession MIMAT0038081
Sequence

19 - 

uguaaacauccuacacucucagc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-30c-2-3p

Accession MIMAT0038083
Sequence

60 - 

ugggagaaggcuguuuacucu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).