Stem-loop sequence ami-mir-23b

AccessionMI0029679 (change log)
DescriptionAlligator mississippiensis miR-23b stem-loop
Stem-loop
   -c   gu  ug     g u   --          -  c      gugacu 
5'   cca  gu  uggcu u ugg  guuccuggca ug ugauuu      u
     |||  ||  ||||| | |||  |||||||||| || ||||||       
3'   ggu  ca  accga a acc  uagggaccgu ac acuaaa      a
   uc   ac  gu     g c   au          u  -      auuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006358.1: 16892962-16893058 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-23b
ami-mir-23bAKHW03006358.1: 16892962-16893058 [-]
ami-mir-27bAKHW03006358.1: 16892732-16892827 [-]
ami-mir-24-1AKHW03006358.1: 16892164-16892255 [-]
Database links

Mature sequence ami-miR-23b-5p

Accession MIMAT0038059
Sequence

20 - 

ggguuccuggcaugcugauuu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-23b-3p

Accession MIMAT0038060
Sequence

57 - 

aucacauugccagggauuaccac

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).