Stem-loop sequence ami-mir-23a

AccessionMI0029678 (change log)
DescriptionAlligator mississippiensis miR-23a stem-loop
Stem-loop
   -u  - a       c     -       ug   c      uuuacc 
5'   gc c cagccag ugggg uuccugg  aug gauuuu      c
     || | ||||||| ||||| |||||||  ||| ||||||       
3'   cg g gucgguc accuu agggacc  uac cuaaaa      a
   cc  a c       a     u       gu   a      cccguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03005909.1: 200380-200470 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-23a
ami-mir-23aAKHW03005909.1: 200380-200470 [+]
ami-mir-27aAKHW03005909.1: 200571-200659 [+]
ami-mir-24-2AKHW03005909.1: 200842-200935 [+]
Database links

Mature sequence ami-miR-23a-3p

Accession MIMAT0038058
Sequence

55 - 

aucacauugccagggauuucca

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).