Stem-loop sequence ami-mir-19a

AccessionMI0029674 (change log)
DescriptionAlligator mississippiensis miR-19a stem-loop
Stem-loop
   u    a  u                 --      ---    ag 
5'  gcag cu cuguuaguuuugcauag  uugcac   uaca  a
    |||| || |||||||||||||||||  ||||||   ||||  a
3'  cguc gg gguagucaaaacguauc  aacgug   augu  g
   u    c  u                 ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002195.1: 10810463-10810546 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-19a
ami-mir-17AKHW03002195.1: 10810742-10810828 [-]
ami-mir-18AKHW03002195.1: 10810597-10810682 [-]
ami-mir-19aAKHW03002195.1: 10810463-10810546 [-]
ami-mir-20aAKHW03002195.1: 10810243-10810323 [-]
ami-mir-19bAKHW03002195.1: 10810105-10810191 [-]
ami-mir-92aAKHW03002195.1: 10809989-10810078 [-]
Database links

Mature sequence ami-miR-19a-5p

Accession MIMAT0038051
Sequence

50 - 

ugugcaaaucuaugcaaaacug

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).