Stem-loop sequence ami-mir-16b

AccessionMI0029671 (change log)
DescriptionAlligator mississippiensis miR-16b stem-loop
Stem-loop
   u    ag     u       cgua          ----u g   a 
5'  cagc  ugcuc agcagca    aauacuggag     c agg c
    ||||  ||||| |||||||    ||||||||||     | |||  
3'  gucg  gugag ucgucgu    uuaugaccuc     g ucc u
   g    ga     u       uacg          ucguc g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003879.1: 2724717-2724804 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-16b
ami-mir-15cAKHW03003879.1: 2725258-2725339 [-]
ami-mir-16bAKHW03003879.1: 2724717-2724804 [-]
Database links

Mature sequence ami-miR-16b-5p

Accession MIMAT0038045
Sequence

13 - 

uagcagcacguaaauacuggag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-16b-3p

Accession MIMAT0038046
Sequence

54 - 

ucuccaguauugcauugcugcu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).