Stem-loop sequence ami-mir-16a-1

AccessionMI0029669 (change log)
DescriptionAlligator mississippiensis miR-16a-1 stem-loop
Stem-loop
   au     ucg   c          -  a        uguua    ucu 
5'   gucaa   uac uuagcagcac gu aauauugg     agau   g
     |||||   ||| |||||||||| || ||||||||     ||||   u
3'   cgguu   aug agucgucgug ca uuaugacc     ucua   a
   uc     uga   a          u  a        -----    uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003532.1: 3751753-3751845 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-16a-1
ami-mir-15aAKHW03003532.1: 3751616-3751696 [+]
ami-mir-16a-1AKHW03003532.1: 3751753-3751845 [+]
Database links

Mature sequence ami-miR-16a-5p

Accession MIMAT0038042
Sequence

16 - 

uagcagcacguaaauauuggug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-16a-3p

Accession MIMAT0038043
Sequence

58 - 

ccaguauuaacugugcugcuga

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).