Stem-loop sequence ami-mir-9-1

AccessionMI0029659 (change log)
DescriptionAlligator mississippiensis miR-9-1 stem-loop
Stem-loop
   ---      guug   uc               g      ug  g 
5'    ggguug    uua  uuugguuaucuagcu uaugag  gu u
      ||||||    |||  ||||||||||||||| ||||||  ||  
3'    cccaau    aau  aagccaauagaucga auacuu  ua c
   uac      -aaa   ga               a      cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001603.1: 781209-781296 [+]
intergenic
Database links

Mature sequence ami-miR-9-5p

Accession MIMAT0038027
Sequence

14 - 

ucuuugguuaucuagcuguaug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-9-3p

Accession MIMAT0038028
Sequence

54 - 

uaaagcuagauaaccgaaagu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).