Stem-loop sequence ami-mir-7b

AccessionMI0029658 (change log)
DescriptionAlligator mississippiensis miR-7b stem-loop
Stem-loop
   ------g      u g  cu   a    u u     --    -      ggu 
5'        ccuggg c gu  gga gacu g gauuu  uguu guuucu   g
          |||||| | ||  ||| |||| | |||||  |||| ||||||    
3'        ggaccc g ca  ccu cuga c cuaaa  acaa cgaagg   u
   cugaccg      c a  cu   -    c -     ca    g      aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001603.1: 525875-525969 [-]
intergenic
Database links

Mature sequence ami-miR-7b-5p

Accession MIMAT0038026
Sequence

14 - 

uggaagacuugugauuuuguuguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).