Stem-loop sequence ami-mir-7a-3

AccessionMI0029657 (change log)
DescriptionAlligator mississippiensis miR-7a-3 stem-loop
Stem-loop
   --guc     gcu   cg   a  a   g      u      cug    a 
5'      gucug   cug  ugg ag cua ugauuu guuguu   acuu u
        |||||   |||  ||| || ||| |||||| ||||||   ||||  
3'      cagac   gac  acc uc gau acuaaa caacag   ugga a
   acgcu     -ac   au   g  c   -      -      ---    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001382.1: 115141-115234 [+]
intergenic
Database links

Mature sequence ami-miR-7a-5p

Accession MIMAT0038023
Sequence

17 - 

uggaagacuagugauuuuguugu

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).