Stem-loop sequence ami-mir-7a-2

AccessionMI0029656 (change log)
DescriptionAlligator mississippiensis miR-7a-2 stem-loop
Stem-loop
   ---  -  ac  u   u  a     a       u      cua   cu 
5'    cc ug  cc gua gg agacu gugauuu guuguu   ugg  c
      || ||  || ||| || ||||| ||||||| ||||||   |||   
3'    gg ac  gg uau cc ucuga cacugaa caacag   acu  a
   ucc  u  gu  -   u  g     -       -      --c   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006295.1: 11914583-11914671 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-7a-2
ami-mir-7a-2AKHW03006295.1: 11914583-11914671 [+]
ami-mir-1720AKHW03006295.1: 11914844-11914915 [+]
Database links

Mature sequence ami-miR-7a-5p

Accession MIMAT0038023
Sequence

13 - 

uggaagacuagugauuuuguugu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-7a-2-3p

Accession MIMAT0038025
Sequence

55 - 

caacaagucacagucugccuu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).