Stem-loop sequence ami-mir-7a-1

AccessionMI0029655 (change log)
DescriptionAlligator mississippiensis miR-7a-1 stem-loop
Stem-loop
   u     a  u        a     a       u      --     a 
5'  ggucu gu cugugugg agacu gugauuu guuguu  uuuag u
    ||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'  ccaga ca gguauacc ucuga cgcuaaa caacag  aaauc a
   a     -  c        g     -       -      cu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006358.1: 19475557-19475647 [+]
intergenic
Database links

Mature sequence ami-miR-7a-5p

Accession MIMAT0038023
Sequence

16 - 

uggaagacuagugauuuuguugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-7a-3p

Accession MIMAT0038024
Sequence

59 - 

aacaaaucgcagucugccauau

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).