Stem-loop sequence ami-mir-1b

AccessionMI0029654 (change log)
DescriptionAlligator mississippiensis miR-1b stem-loop
Stem-loop
   -    -u     ccc            c    gc     --ugg  u 
5'  uccc  cccaa   uacauacuucuu auau  ccaua     ag c
    ||||  |||||   |||||||||||| ||||  |||||     ||  
3'  aggg  ggguu   auguaugaagaa ugua  gguau     uc g
   c    uc     ucu            u    -a     uaugg  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000257.1: 2164083-2164173 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-1b
ami-mir-1bAKHW03000257.1: 2164083-2164173 [-]
ami-mir-133a-3AKHW03000257.1: 2163873-2163958 [-]
Database links

Mature sequence ami-miR-1b-5p

Accession MIMAT0038021
Sequence

14 - 

uacauacuucuucauaugccca

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-1b-3p

Accession MIMAT0038022
Sequence

56 - 

uggaauguuaagaaguauguau

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).