Stem-loop sequence ami-mir-1a-2

AccessionMI0029653 (change log)
DescriptionAlligator mississippiensis miR-1a-2 stem-loop
Stem-loop
   --a      c                     ac     ugaaca 
5'    ccugcc agaguacauacuucuuuaugu  ccaua      u
      |||||| |||||||||||||||||||||  |||||       
3'    ggacgg uuuuauguaugaagaaaugua  gguau      a
   cac      u                     -a     cguaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000230.1: 130792-130878 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-1a-2
ami-mir-1a-2AKHW03000230.1: 130792-130878 [-]
ami-mir-133a-1AKHW03000230.1: 127265-127353 [-]
Database links

Mature sequence ami-miR-1a-2-5p

Accession MIMAT0038020
Sequence

14 - 

acauacuucuuuauguacccaua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-1a-3p

Accession MIMAT0038019
Sequence

53 - 

uggaauguaaagaaguauguau

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).