Stem-loop sequence ami-mir-1a-1

AccessionMI0029652 (change log)
DescriptionAlligator mississippiensis miR-1a-1 stem-loop
Stem-loop
   -   -acua  ug       g                gc     ugaacc 
5'  gaa     cc  cuugaga acauacuucuuuauau  ccaua      u
    |||     ||  ||||||| ||||||||||||||||  |||||       
3'  cuu     gg  ggacuuu uguaugaagaaaugua  gguau      g
   u   acuag  gu       a                -a     cgaacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001485.1: 1710007-1710105 [-]
intergenic
Database links

Mature sequence ami-miR-1a-5p

Accession MIMAT0038018
Sequence

20 - 

acauacuucuuuauaugcccauau

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-1a-3p

Accession MIMAT0038019
Sequence

59 - 

uggaauguaaagaaguauguau

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).