Stem-loop sequence ami-let-7i

AccessionMI0029651 (change log)
DescriptionAlligator mississippiensis let-7i stem-loop
Stem-loop
   cg uc     u                 u   --------  u     u u 
5'   g  cuggc gagguaguaguuugugc guu        gg cgggu g g
     |  ||||| ||||||||||||||||| |||        || ||||| | a
3'   c  gaucg uuccgucaucgaacgcg caa        uc gcccg c c
   -g gu     -                 u   uagaggug  -     u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000416.1: 29268632-29268725 [+]
intergenic
Database links

Mature sequence ami-let-7i-5p

Accession MIMAT0038016
Sequence

11 - 

ugagguaguaguuugugcugu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7i-3p

Accession MIMAT0038017
Sequence

67 - 

cugcgcaagcuacugccuugcu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).