Stem-loop sequence ami-let-7g

AccessionMI0029650 (change log)
DescriptionAlligator mississippiensis let-7g stem-loop
Stem-loop
   gc   a     a  u        a            ugag     -a  a    a 
5'   cug uucca gc gagguagu guuuguacaguu    ggucu  ug uacc c
     ||| ||||| || |||||||| ||||||||||||    |||||  || ||||  
3'   gac agggu cg uuccguca cggacaugucaa    uuaga  ac augg c
   --   -     c  -        c            ----     gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003049.1: 483082-483183 [-]
intergenic
Database links

Mature sequence ami-let-7g-5p

Accession MIMAT0038014
Sequence

15 - 

ugagguaguaguuuguacaguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7g-3p

Accession MIMAT0038015
Sequence

73 - 

cuguacaggccacugccuugc

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).