Stem-loop sequence ami-let-7f-2

AccessionMI0029649 (change log)
DescriptionAlligator mississippiensis let-7f-2 stem-loop
Stem-loop
   -ua    a ug                      ---------       u 
5'    ucag g  agguaguagauuguauaguugu         gggguag u
      |||| |  ||||||||||||||||||||||         ||||||| a
3'    aguc c  uccguuaucuaacauaucaaua         ucccauu u
   agg    - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004488.1: 7299080-7299171 [+]
intergenic
Clustered miRNAs
< 10kb from ami-let-7f-2
ami-let-7a-1AKHW03004488.1: 7298627-7298712 [+]
ami-let-7f-2AKHW03004488.1: 7299080-7299171 [+]
ami-let-7dAKHW03004488.1: 7300952-7301038 [+]
Database links

Mature sequence ami-let-7f-5p

Accession MIMAT0038012
Sequence

9 - 

ugagguaguagauuguauagu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7f-3p

Accession MIMAT0038013
Sequence

65 - 

cuauacaaucuauugccuucc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).