Stem-loop sequence ami-let-7f-1

AccessionMI0029648 (change log)
DescriptionAlligator mississippiensis let-7f-1 stem-loop
Stem-loop
   -cc        ug  cu   gu     au        ----    g  ca 
5'    gggcggcg  gg  gag  aguag  uguauagu    ucug gu  c
      ||||||||  ||  |||  |||||  ||||||||    |||| ||  a
3'    cuugucgc  cc  uuc  ucauc  acauauca    aggc cg  c
   ccc        gu  -u   ug     cg        auag    g  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001570.1: 8030-8126 [-]
intergenic
Clustered miRNAs
< 10kb from ami-let-7f-1
ami-let-7f-1AKHW03001570.1: 8030-8126 [-]
ami-mir-98AKHW03001570.1: 7585-7667 [-]
Database links

Mature sequence ami-let-7f-5p

Accession MIMAT0038012
Sequence

16 - 

ugagguaguagauuguauagu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).