Stem-loop sequence ami-let-7e

AccessionMI0029647 (change log)
DescriptionAlligator mississippiensis let-7e stem-loop
Stem-loop
   --g     g   cu   gu         a      -  ------    uc 
5'    uccuu agg  gag  aguagauug auaguu gu      ggag  c
      ||||| |||  |||  ||||||||| |||||| ||      ||||  u
3'    aggaa ucc  uuc  ucaucuaac uaucaa cg      ccuc  a
   cag     -   -u   ug         a      u  aguuuc    cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003787.1: 755426-755517 [+]
intergenic
Clustered miRNAs
< 10kb from ami-let-7e
ami-let-7eAKHW03003787.1: 755426-755517 [+]
ami-let-7a-4AKHW03003787.1: 755667-755758 [+]
Database links

Mature sequence ami-let-7e-5p

Accession MIMAT0038010
Sequence

12 - 

ugagguaguagauugaauaguu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7e-3p

Accession MIMAT0038011
Sequence

62 - 

cuauacaaucuacugucuuu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).