Stem-loop sequence ami-let-7d

AccessionMI0029646 (change log)
DescriptionAlligator mississippiensis let-7d stem-loop
Stem-loop
   ----     a              c      -------uua      g 
5'     uagga gagguaguagguug auaguu          gggcag g
       ||||| |||||||||||||| ||||||          |||||| a
3'     auucu uuccgucguccaac uaucaa          cucguu u
   cggg     -              a      uugaggcaca      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004488.1: 7300952-7301038 [+]
intergenic
Clustered miRNAs
< 10kb from ami-let-7d
ami-let-7a-1AKHW03004488.1: 7298627-7298712 [+]
ami-let-7f-2AKHW03004488.1: 7299080-7299171 [+]
ami-let-7dAKHW03004488.1: 7300952-7301038 [+]
Database links

Mature sequence ami-let-7d-5p

Accession MIMAT0038008
Sequence

6 - 

agagguaguagguugcauag

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7d-3p

Accession MIMAT0038009
Sequence

60 - 

cuauacaaccugcugccuuuc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).