Stem-loop sequence ami-let-7c-2

AccessionMI0029645 (change log)
DescriptionAlligator mississippiensis let-7c-2 stem-loop
Stem-loop
   g  u      -     u   g   u             uagag  aca 
5'  gg gggggc cgggg gag uag agguuguaugguu     uc   c
    || |||||| ||||| ||| ||| |||||||||||||     ||    
3'  cc cccccg gcccc uuc auc uccgacaugucaa     gg   c
   a  -      c     u   g   c             -uaga  ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006683.1: 238111-238205 [-]
intergenic
Clustered miRNAs
< 10kb from ami-let-7c-2
ami-mir-99bAKHW03006683.1: 238448-238536 [-]
ami-let-7c-2AKHW03006683.1: 238111-238205 [-]
ami-mir-125aAKHW03006683.1: 234116-234210 [-]
Database links

Mature sequence ami-let-7c-5p

Accession MIMAT0038005
Sequence

16 - 

ugagguaguagguuguaugguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7c-2-3p

Accession MIMAT0038007
Sequence

61 - 

cuguacagccuccuagcuuucc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).