Stem-loop sequence ami-let-7c-1

AccessionMI0029644 (change log)
DescriptionAlligator mississippiensis let-7c-1 stem-loop
Stem-loop
   u      a      uu   g   u             ua  g ua a 
5'  gugugc uccggg  gag uag agguuguaugguu  ga u  c c
    |||||| ||||||  ||| ||| |||||||||||||  || |  | c
3'  cacacg agguuc  uuc auc uccaacaugucaa  uu a  g c
   u      -      cu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006231.1: 37235551-37235644 [+]
intergenic
Clustered miRNAs
< 10kb from ami-let-7c-1
ami-mir-99aAKHW03006231.1: 37234781-37234870 [+]
ami-let-7c-1AKHW03006231.1: 37235551-37235644 [+]
Database links

Mature sequence ami-let-7c-5p

Accession MIMAT0038005
Sequence

16 - 

ugagguaguagguuguaugguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7c-3p

Accession MIMAT0038006
Sequence

61 - 

cuguacaaccuucuagcuuucc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).