Stem-loop sequence ami-let-7b

AccessionMI0029643 (change log)
DescriptionAlligator mississippiensis let-7b stem-loop
Stem-loop
   gcucugg    au                     ucaggguagugauuu 
5'        cagg  gagguaguagguugugugguu               u
          ||||  |||||||||||||||||||||                
3'        gucc  uuccgucauccaacauaucaa               g
   -------    -c                     uagaggacuaacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000678.1: 7945988-7946079 [-]
intergenic
Clustered miRNAs
< 10kb from ami-let-7b
ami-let-7a-3AKHW03000678.1: 7946891-7946981 [-]
ami-let-7bAKHW03000678.1: 7945988-7946079 [-]
Database links

Mature sequence ami-let-7b-5p

Accession MIMAT0038003
Sequence

13 - 

ugagguaguagguugugugguu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7b-3p

Accession MIMAT0038004
Sequence

69 - 

cuauacaaccuacugccuuccc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).