Stem-loop sequence ami-let-7a-4

AccessionMI0029642 (change log)
DescriptionAlligator mississippiensis let-7a-4 stem-loop
Stem-loop
   ---- g    u          gu         ---ugg  gg -       
5'     u gagg gagguaguag  uguauaguu      ug  a gggauu 
       | |||| ||||||||||  |||||||||      ||  | ||||| u
3'     a uucc uuccguuauc  acauaucaa      ac  u cccuac 
   gaga g    -          ug         uagugg  uu a       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003787.1: 755667-755758 [+]
intergenic
Clustered miRNAs
< 10kb from ami-let-7a-4
ami-let-7eAKHW03003787.1: 755426-755517 [+]
ami-let-7a-4AKHW03003787.1: 755667-755758 [+]
Database links

Mature sequence ami-let-7a-5p

Accession MIMAT0037999
Sequence

7 - 

ugagguaguagguuguauaguu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7a-4-3p

Accession MIMAT0038002
Sequence

64 - 

cuauacagucuauugccuuc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).