Stem-loop sequence ami-let-7a-3

AccessionMI0029641 (change log)
DescriptionAlligator mississippiensis let-7a-3 stem-loop
Stem-loop
   -  -   ug   u   gu                ---------u     u 
5'  uc cuu  ggg gag  aguagguuguauaguu          uaggg u
    || |||  ||| |||  ||||||||||||||||          ||||| a
3'  gg gaa  ccu uuc  ucaucuaacauaucaa          guccc u
   c  u   gu   -   ug                uagacugucc     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000678.1: 7946891-7946981 [-]
intergenic
Clustered miRNAs
< 10kb from ami-let-7a-3
ami-let-7a-3AKHW03000678.1: 7946891-7946981 [-]
ami-let-7bAKHW03000678.1: 7945988-7946079 [-]
Database links

Mature sequence ami-let-7a-5p

Accession MIMAT0037999
Sequence

11 - 

ugagguaguagguuguauaguu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7a-3p

Accession MIMAT0038000
Sequence

61 - 

cuauacaaucuacugucuuu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).