Stem-loop sequence ami-let-7a-2

AccessionMI0029640 (change log)
DescriptionAlligator mississippiensis let-7a-2 stem-loop
Stem-loop
   ac    u c       uu   g   u             uagaaugac 
5'   ugca g auccagg  gag uag agguuguauaguu         a
     |||| | |||||||  ||| ||| |||||||||||||         c
3'   acgu c uggguuc  uuc auc uccaacaugucaa         c
   -c    u -       cu   g   c             uagagggaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002395.1: 3936824-3936920 [+]
intergenic
Database links

Mature sequence ami-let-7a-5p

Accession MIMAT0037999
Sequence

18 - 

ugagguaguagguuguauaguu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7a-2-3p

Accession MIMAT0038001
Sequence

63 - 

cuguacaaccuccuagcuuucc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).