Stem-loop sequence ami-let-7a-1

AccessionMI0029639 (change log)
DescriptionAlligator mississippiensis let-7a-1 stem-loop
Stem-loop
   ----g     u   gu                uuagg   aua    c 
5'      uggga gag  aguagguuguauaguu     guc   ccca a
        ||||| |||  ||||||||||||||||     |||   ||||  
3'      auccu uuc  ucaucuaacauaucaa     uag   gggu a
   acgaa     -   ug                -----   --a    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004488.1: 7298627-7298712 [+]
intergenic
Clustered miRNAs
< 10kb from ami-let-7a-1
ami-let-7a-1AKHW03004488.1: 7298627-7298712 [+]
ami-let-7f-2AKHW03004488.1: 7299080-7299171 [+]
ami-let-7dAKHW03004488.1: 7300952-7301038 [+]
Database links

Mature sequence ami-let-7a-5p

Accession MIMAT0037999
Sequence

7 - 

ugagguaguagguuguauaguu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-let-7a-3p

Accession MIMAT0038000
Sequence

58 - 

cuauacaaucuacugucuuu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).