Stem-loop sequence cpi-mir-9597

AccessionMI0029634 (change log)
DescriptionChrysemys picta miR-9597 stem-loop
Stem-loop
   cuu             a   c        a  -  ua 
5'    gggcccagauccu aga guauuuag ug cu  a
      ||||||||||||| ||| |||||||| || ||  c
3'    cccgggucuagga uuu uauaaauc au ga  a
   agu             c   c        c  a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr6: 5703773-5703848 [+]
intergenic
Database links

Mature sequence cpi-miR-9597-5p

Accession MIMAT0037990
Sequence

10 - 

agauccuaagacguauuuaga

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-9597-3p

Accession MIMAT0037991
Sequence

49 - 

uaaauaucuuucaggaucugg

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).