Stem-loop sequence cpi-mir-9596

AccessionMI0029633 (change log)
DescriptionChrysemys picta miR-9596 stem-loop
Stem-loop
      a             g      cc   g        c  gauu 
5' aag aguaacgcuuccu cuaguu  agc caguccag au    a
   ||| ||||||||||||| ||||||  ||| |||||||| ||     
3' uuc ucguugugaagga gaucaa  ucg gucagguc ug    g
      g             a      ca   g        a  ggaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082921.1: 8817053-8817144 [-]
intergenic
Database links

Mature sequence cpi-miR-9596-5p

Accession MIMAT0037988
Sequence

17 - 

ugcuaguuccagcgcaguccag

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-9596-3p

Accession MIMAT0037989
Sequence

60 - 

cugggcuacaacuagaaggaag

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).