Stem-loop sequence cpi-mir-9594

AccessionMI0029631 (change log)
DescriptionChrysemys picta miR-9594 stem-loop
Stem-loop
   uua     ua     a a   -       cg      ---    uuu 
5'    ggcca  uccuc g cag uguaaau  gcauag   cgcu   a
      |||||  ||||| | ||| |||||||  ||||||   ||||   a
3'    ccggu  aggag c guc acauuua  cguguc   guga   c
   uac     cc     c -   u       au      uag    cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088244.1: 252269-252360 [-]
intergenic
Database links

Mature sequence cpi-miR-9594-5p

Accession MIMAT0037984
Sequence

18 - 

acaguguaaaucggcauagcgc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-9594-3p

Accession MIMAT0037985
Sequence

56 - 

ucugugcuaauuuacaucugccg

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).