Stem-loop sequence cpi-mir-9587

AccessionMI0029624 (change log)
DescriptionChrysemys picta miR-9587 stem-loop
Stem-loop
   u   -    g   ucc      --    aa       a   ca   auca 
5'  gca uccg cca   cucuuc  agca  gcaccga gca  cgc    c
    ||| |||| |||   ||||||  ||||  ||||||| |||  |||     
3'  cgu aggc ggu   gagaag  ucgu  cguggcu cgu  gcg    c
   u   c    -   ---      ac    --       g   ac   aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082950.1: 928166-928258 [+]
intergenic
Database links

Mature sequence cpi-miR-9587-5p

Accession MIMAT0037970
Sequence

21 - 

cagcaaagcaccgaagcacacg

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-9587-3p

Accession MIMAT0037971
Sequence

56 - 

gcaugcgucggugcugcucaga

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).