Stem-loop sequence cpi-mir-9585

AccessionMI0029622 (change log)
DescriptionChrysemys picta miR-9585 stem-loop
Stem-loop
   ----     g               c             ------      c 
5'     cuccg aguuggggcaccgau guuggcgacucag      gcuccu c
       ||||| ||||||||||||||| |||||||||||||      ||||||  
3'     gaggc ucaacuccguggcua caaccgcugaguc      cgaggg a
   ucca     -               a             ccauga      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr2: 20574021-20574115 [-]
intergenic
Database links

Mature sequence cpi-miR-9585-5p

Accession MIMAT0037966
Sequence

15 - 

caccgaucguuggcgacucagg

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-9585-3p

Accession MIMAT0037967
Sequence

59 - 

ugagucgccaacaaucggugcc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).