Stem-loop sequence cpi-mir-1729

AccessionMI0029616 (change log)
DescriptionChrysemys picta miR-1729 stem-loop
Stem-loop
   -----ucu  ag ug   c  a             -a    c g ccc 
5'         gg  c  auc ug agcccuuacucac  ugag a u   a
           ||  |  ||| || |||||||||||||  |||| | |    
3'         cc  g  uag gc ucgggaaugagug  acuc u a   c
   ccauaaau  ca gu   a  g             ga    c g aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088243.1: 4156550-4156641 [-]
intergenic
Database links

Mature sequence cpi-miR-1729-5p

Accession MIMAT0037954
Sequence

17 - 

aagcccuuacucacaugagca

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1729-3p

Accession MIMAT0037955
Sequence

52 - 

cucaaggugaguaagggcugcg

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).