Stem-loop sequence cpi-mir-2984

AccessionMI0029611 (change log)
DescriptionChrysemys picta miR-2984 stem-loop
Stem-loop
   --------c     ca a       a    a   c aa aa    ca 
5'          uacag  g ucuguug gagu aaa u  c  ggau  u
            |||||  | ||||||| |||| ||| |  |  ||||   
3'          auguu  c ggacgac cuca uuu a  g  ccua  g
   acgaaauga     -a -       a    c   a cg ac    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088176.1: 9368860-9368945 [+]
intergenic
Database links

Mature sequence cpi-miR-2984-3p

Accession MIMAT0037947
Sequence

53 - 

aauuucacucacagcaggcauu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).