Stem-loop sequence cpi-mir-2188

AccessionMI0029609 (change log)
DescriptionChrysemys picta miR-2188 stem-loop
Stem-loop
   ---     caaa         a     ca   u  c       g aug 
5'    aauau    ccuguggga agguc  acc ca auguccu u   u
      |||||    ||||||||| |||||  ||| || ||||||| |   a
3'    uuaug    ggacacccu uccag  ugg gu uguaggg a   a
   uuc     uccc         a     ac   u  a       g aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr2: 35881772-35881867 [-]
intergenic
Database links

Mature sequence cpi-miR-2188-5p

Accession MIMAT0037943
Sequence

19 - 

aagguccaaccucacauguccu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-2188-3p

Accession MIMAT0037944
Sequence

56 - 

gauguauguggucagaccuau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).