Stem-loop sequence cpi-mir-2184

AccessionMI0029608 (change log)
DescriptionChrysemys picta miR-2184 stem-loop
Stem-loop
   ---gccc  g        caaa     a              ugaga 
5'        uu gguuuccc    cagua gaguuuaugugcgg     g
          || ||||||||    ||||| ||||||||||||||     c
3'        ag ucggaggg    gucau cucagguguacguc     u
   accauga  g        ccuc     c              uaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083788.1: 17035-17128 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-2184
cpi-mir-2184KK083788.1: 17035-17128 [+]
cpi-mir-132KK083788.1: 18748-18835 [-]
cpi-mir-212KK083788.1: 25119-25211 [-]
Database links

Mature sequence cpi-miR-2184-5p

Accession MIMAT0037941
Sequence

18 - 

aacaguaagaguuuaugugcgg

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-2184-3p

Accession MIMAT0037942
Sequence

55 - 

gcauguggacuccuacugcucc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).