Stem-loop sequence cpi-mir-1805

AccessionMI0029607 (change log)
DescriptionChrysemys picta miR-1805 stem-loop
Stem-loop
   ----agu    ua   u            c      -    agcucugc 
5'        ggaa  uuc gggaguuguagu uuucaa acag        a
          ||||  ||| |||||||||||| |||||| ||||         
3'        ccuu  aag cccucgacauca aagguu uguc        a
   cugugau    -c   c            c      a    cauauaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082916.1: 7072762-7072855 [-]
intergenic
Database links

Mature sequence cpi-miR-1805-5p

Accession MIMAT0037939
Sequence

17 - 

aguuguagucuuucaaacaga

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1805-3p

Accession MIMAT0037940
Sequence

56 - 

uguauuggaacacuacagcuc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).