Stem-loop sequence cpi-mir-1791

AccessionMI0029606 (change log)
DescriptionChrysemys picta miR-1791 stem-loop
Stem-loop
   ugcac     ug g             gc a     ug 
5'      caugu  g cugcaucagucau  c uguua  a
        |||||  | |||||||||||||  | |||||  a
3'      guaca  c gacguagucagug  g acaau  a
   ----a     gu g             ua c     cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr15: 15142532-15142606 [+]
intergenic
Database links

Mature sequence cpi-miR-1791-5p

Accession MIMAT0037938
Sequence

11 - 

ugggcugcaucagucaugccau

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).