Stem-loop sequence cpi-mir-1788

AccessionMI0029605 (change log)
DescriptionChrysemys picta miR-1788 stem-loop
Stem-loop
   ----c    -     g             c         c    ggu 
5'      ccuc ugugu ucgggcuuguuuu aguugccug gguu   u
        |||| ||||| ||||||||||||| ||||||||| ||||   a
3'      ggag gcgca ggucugaacgaaa ucgacggac ucag   g
   caaga    c     g             -         -    gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK085206.1: 12443-12532 [+]
intergenic
Database links

Mature sequence cpi-miR-1788-5p

Accession MIMAT0037936
Sequence

15 - 

ggcuuguuuucaguugccugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1788-3p

Accession MIMAT0037937
Sequence

53 - 

caggcagcuaaagcaagucug

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).