Stem-loop sequence cpi-mir-1784

AccessionMI0029604 (change log)
DescriptionChrysemys picta miR-1784 stem-loop
Stem-loop
   auu       g       c        uucaaa      --  a 
5'    ucuuagg cccaauu ugcucuca      ucaaug  ag g
      ||||||| ||||||| ||||||||      ||||||  ||  
3'    agaaucc ggguuaa acgagggu      aguuac  uc u
   ---       a       c        caauuc      ca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082962.1: 2911653-2911737 [-]
intergenic
Database links

Mature sequence cpi-miR-1784-3p

Accession MIMAT0037935
Sequence

53 - 

ugacuuaacugggagcacaauu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).