Stem-loop sequence cpi-mir-1720

AccessionMI0029603 (change log)
DescriptionChrysemys picta miR-1720 stem-loop
Stem-loop
   -----   u    --a    ag ug        --g      
5'      uuc gauc   ccuc  u  uugcuuuu   ugagg 
        ||| ||||   ||||  |  ||||||||   |||| a
3'      aag cugg   ggag  a  aacgaaag   acucu 
   accca   u    gug    -- gu        aga      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088241.1: 3107406-3107477 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-1720
cpi-mir-7a-2KK088241.1: 3107639-3107733 [-]
cpi-mir-1720KK088241.1: 3107406-3107477 [-]
Database links

Mature sequence cpi-miR-1720-3p

Accession MIMAT0037934
Sequence

44 - 

aagcaaugagagggugggucuga

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).