Stem-loop sequence cpi-mir-1677h

AccessionMI0029602 (change log)
DescriptionChrysemys picta miR-1677h stem-loop
Stem-loop
   ucu           gc          a     --  ug a 
5'    ggggcucaacu  ucucccaauu aguca  gu  g c
      |||||||||||  |||||||||| |||||  ||  |  
3'    uccugaguugg  agaggguuaa ucagu  ua  u u
   guc           ga          a     uu  gu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr15: 4640620-4640699 [+]
intergenic
Database links

Mature sequence cpi-miR-1677h-5p

Accession MIMAT0037932
Sequence

11 - 

aacugcucucccaauuaaguca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1677h-3p

Accession MIMAT0037933
Sequence

51 - 

acuaaauugggagaaggguuga

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).