Stem-loop sequence cpi-mir-1677e

AccessionMI0029598 (change log)
DescriptionChrysemys picta miR-1677e stem-loop
Stem-loop
   aau  -  c   u   cu     c    -       a   caaa 
5'    gc uc cuc agg  cugau caaa cccauug aau    g
      || || ||| |||  ||||| |||| ||||||| |||     
3'    cg ag gag ucc  gacua guuu ggguaac uua    g
   cuc  u  u   -   ug     a    c       c   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr6: 3011703-3011789 [+]
intergenic
Database links

Mature sequence cpi-miR-1677e-5p

Accession MIMAT0037928
Sequence

17 - 

ucugauccaaacccauugaaa

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1677e-3p

Accession MIMAT0037929
Sequence

50 - 

uuccaaugggcuuugaaucaggu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).