Stem-loop sequence cpi-mir-1677a

AccessionMI0029594 (change log)
DescriptionChrysemys picta miR-1677a stem-loop
Stem-loop
   --- u   gaug   c    uu    u             ---------        
5'    g cug    ggg cuga  caga cccauugaaguca         augagaa 
      | |||    ||| ||||  |||| |||||||||||||         |||||| u
3'    c gac    ccc gacu  guuu gggugacuucagu         uacuuua 
   uca u   ---a   a    ug    c             caucgaguu        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082962.1: 3830066-3830163 [-]
intergenic
Database links

Mature sequence cpi-miR-1677a-5p

Accession MIMAT0037920
Sequence

19 - 

ucagaucccauugaagucaaug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1677a-3p

Accession MIMAT0037921
Sequence

61 - 

cugacuucagugggcuuugguu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).