Stem-loop sequence cpi-mir-1662

AccessionMI0029593 (change log)
DescriptionChrysemys picta miR-1662 stem-loop
Stem-loop
   ugu  --   a             aucauacuugagauguaug 
5'    gc  ucu uggguuugacauc                   a
      ||  ||| |||||||||||||                    
3'    cg  aga acccggacuguag                   c
   -gu  gu   -             ucggacgaacccugaaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082971.1: 3853380-3853463 [-]
intergenic
Database links

Mature sequence cpi-miR-1662-5p

Accession MIMAT0037918
Sequence

15 - 

uugacaucaucauacuugagau

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1662-3p

Accession MIMAT0037919
Sequence

51 - 

cccaagcaggcugaugucagg

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).