Stem-loop sequence cpi-mir-1641

AccessionMI0029592 (change log)
DescriptionChrysemys picta miR-1641 stem-loop
Stem-loop
          -------         -           u      ucau 
5' agggcau       uuccugggg auuaaugacug cugggg    c
   |||||||       ||||||||| ||||||||||| ||||||    a
3' uuccgug       aaggacccc ugauuauugau gacccu    u
          ugucaua         c           u      ccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr3: 3228974-3229060 [-]
intergenic
Database links

Mature sequence cpi-miR-1641-5p

Accession MIMAT0037917
Sequence

12 - 

uggggauuaaugacugucuggg

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).