Stem-loop sequence cpi-mir-1416

AccessionMI0029591 (change log)
DescriptionChrysemys picta miR-1416 stem-loop
Stem-loop
   gau ga   c  -  --c            cgc    ccuuuca 
5'    g  uga ac cu   cuuaacucaugc   ugug       c
      |  ||| || ||   ||||||||||||   ||||       c
3'    c  acu ug ga   gaguugaguaug   acac       c
   --u ag   a  a  cau            uua    ccucacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082927.1: 9195609-9195694 [-]
intergenic
Database links

Mature sequence cpi-miR-1416-5p

Accession MIMAT0037916
Sequence

14 - 

uccuuaacucaugccgcugug

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).