Stem-loop sequence cpi-mir-1388

AccessionMI0029589 (change log)
DescriptionChrysemys picta miR-1388 stem-loop
Stem-loop
   --- u    -         a  a   u u         a   ugaaa 
5'    g gagg gguguuucg gg cug c aaccugaga ugg     c
      | |||| ||||||||| || ||| | ||||||||| |||     a
3'    c cucu ccgcagagu cc gac g uuggacucu acu     u
   aga -    u         a  c   u c         a   ggaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082954.1: 1007712-1007803 [-]
intergenic
Database links

Mature sequence cpi-miR-1388-5p

Accession MIMAT0037913
Sequence

16 - 

aggacugucuaaccugagaau

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1388-3p

Accession MIMAT0037914
Sequence

55 - 

aucucagguucgucagcccau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).